Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658926
Length 532 bp
Fasta Format > whhg17f14
cggtctccctccctccctccctatcgtctgtttccttcggccgaaaagct ccccgttccctgcccctgctccgcccctcgatccccagcctccgctccgc tcttggtaattggatacatggcctcacccgccacaccgacacagtccacc ggcgcccaggaggaggccgcggcccgccagtcgctcatcgggatctccca gtccaccccggcagcaggggaggccctcagcgtcaagtcgccgaacggcc gcacggaacacgggcaggacgacagcggggcggccgacaagtccaggtcg atgctcatgtccatctccaaccagtccccggaggctcgccagcccacgcc gtgcccgcacagcaacgccgcttaagcttgatattagccctgtaatagta ctgattagccctgcagccgcatctgtcgatatgttgcgcacccttgtgtg gcgctcttaataatcgccatgttcctgggttttcggtgatgaaatgatat gcaatgtggaatactactgattaaaaaaaaaa
Download
page-top