Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658874
Length 786 bp
Fasta Format > whhg17b16
gccccgacgctcaagcccccagacgccgcagcgccgccactccacccgca gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaa gggtagcaaaaagaaggccgtcgatccgttcaccaagaagcagtggtatg acatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctc gtgtccaggacacagggtaccaagattgcctcagagggtctgaagcacag ggtgttcgaagtatctctagctgatcttcagaacgatgaggaccaggcct acaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctc acaaacttctggggcatggacttcaccactgacaagctcaggtctcttgt gaggaagtggcagacactcattgaggctcatgtggatgtgaagaccactg acaactacatgctccgcatgttcaccattggcttcacgaagagacgccca aaccaggtgaagcgcacttgctatgcccaagcaagtcagatcanacagat ccgccgcaagatggttgagatcatggtcaaccaagctgcaagctgtgact tgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagatt ganaaggccacctcaagcatcttccccctccagaacgtgtacgtccgcaa ggtgaagatcctgaangcccccaagtttgacctggggaanctcatggagg tgcacggtgactacaaggangatgttggtgtgaanc
Download
page-top