Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658852
Length 304 bp
Fasta Format > whhg16p22
gcatggtcgatgtggccattcaaaatcctctaatatgaaaagaggaggtc aagtagtttgaggcggcaatggcctattttggtagtttttctatcctcgt gagtatccctcttgacttgcctgtgctcgacttgaatcgttctccctatt agatgggtgaacaaaaattcatgttatcttgttacattgtcctttttacc gagtcatccacatatctgtcatcattgaaacaagaaaagaaaggtgtgtg gacgtcagaaatgatctaactgagagcttgtgagctctggaagtaaaaaa aaaa
Download
page-top