Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658847
Length 793 bp
Fasta Format > whhg16p12
gccaccaaatccaatctcgagcccccctctcccgtccgcccgtcccaacc cgatccgatctcccccctcctcctccgtcgccatgggccgcaagttcttc gtcggcggcaactggaaatgcaatggaactgtcgaacaggtagagagcat cgtcaatactctgaacgctggacagatcgcctctacggatgttgtcgagg ttgtcgttagcccgccctatgtcttccttcccaccgtcaagggtaagctg cgcccagagatccaagttgctgctcagaactgctgggtgaagaagggcgg tgctttcaccggtgaagtcagtgctgagatgcttgtcaacctcggcgttc cctgggtcatccttggacactctgaaaggaggagcttgatgggagaatca agcgagtttgttggagagaaggttgcatatgcactcgctcagggcttgaa ggtcattgcatgtgttggtgagactcttgagcagcgagaagctggatcaa ccatggcggttgtcgctgaacagacaaaagcaattgctgacaagatcaag gactggaccaacgtggtcgtcgcctatgaaccagtgtgggccattggcac cggtaaagttgcatcaccggctcaggcacaggaagtccatgccaatctga gggactggctcaagaccaatgtgagccccgaggttgctgaatccacgcgg atcatctatggaggatctgtaactggcgcaagctgcaaggagttggccgc gcancccgacgtcnatggtttcctcgttggtggagcttccttg
Download
page-top