Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658845
Length 816 bp
Fasta Format > whhg16p10
gagagcgagggcgaccaataaattcctaatttttcgcacttttccgcccc gggattcccccacctcttgttccaatcgattggtgggcgtcctcgttctt ggcttcccgattgaatccgtgggaagccagagataattctctctccactg cgaatttttttggtggttcgagttcttgatttgtttgcgaggaagccacc atgagcgccggaagcgccagtttcctcgagatccagccctcggagctggc atttccctttgaattgatgaagcagagctcgtgctccatgcaactcacaa ataagaccgaccattatgtagcattcaaggtcaaaactaccaacccaaag cagtactgtgtgcgccctaatattggcgttgtacttcctgggtcgacttg tgatgttacagttacaatgcaagcgcagagggaagcacctcctgatctgc agtgtaaggacaagttcctagttcaaagtgttgcagctgagaatggcgca gaaactcaagatattagtgcagcaatgttcaacaaagagccagggaaggt tgttgatgaatgcaagctgcgtgtaatttatgtgccaacatcttcaccta gcccgttctctgaagaatcagaacaagggagttctgctcgttcattggaa aatgggacccctaattctacattgccacaatctgtatttanatcatctgg tgaagcatcaaaggagaagtcctcggaggcaacatccatgatttccaagc taactgaggagaaaatgtctgctgttcancaaaaccanaagttgagacaa gagctggatgtcctac
Download
page-top