Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658842
Length 742 bp
Fasta Format > whhg16p06
gtgcagtcctgggaattcgaacagttcatcaacagaagccagttcgttta caacaacaaaggtggcatctacagggagctcctgccaaaggccgagtact tctcccaggcgctgtacaccttcgacatcggccaaaacgacatcaccgcg ggctacttcgcgaacatgacgagtgaacaagtcgtagcgttcattcctga gctcatggagaggctcacctcaataatccagagcgtgcatgtgctcggtg gaaggaacttctggatccacagcacggggcctatcggctgcctgccttac gccctcattcgccggcccgacatcgccgcggtcaaggacaatgttggctg ctctgtcacctacaacaaggtcgcgcaactcttcaaccagaggctcaagg aaacagtggctcatcttcggaaaacctaccctgacgccgcgttcacctac gtcgatgtctacgccgcgaagtacaagctgatcagccaagccagcaagct aggcttcgacgaccctctgctcacctgctgcgggcacgacgctggcccgt acaacttcgacccgaaggttggttgtggcgggaaggtgctggtgaagggg aagtgggtggtgctgggaaaatcctgcgacnacccggccanganagtgan ctgggacngcntccacttcaccgaggcggnnaacaanttcttctttgatc anatcntcngnnnnngnntctcnnanccnnccatgcccctna
Download
page-top