Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658811
Length 711 bp
Fasta Format > whhg16n04
aagttgaagagggaaaaaagccaagagaagaagaacaaaatggacagtgg cggttcatccggtggaaacaatcaaggcaagaaaaagagcaagaaacgtg tgctgaccgctgaagagctggaaaaccggcggcttgagaacgtgcaacct acctcttgggacgatgagtggattgtaacactgaacatcacagataacgt ggtggaggatgaagacactagtagcatggtgagcactttctcgacagaca gccccttctcgatagaccccgaggaggagactgacaaggaggaggctgac aatgaagaggaggaggaggagggggatgaagaggaggctgacaatgagga tgaggaggaggaggatgaagaggggctgacaatgaggatgaggagtagga ggaggaggctgacggaaacggtgacggtgacaagaaaaaggaggatcana ctgacgacgatgatggcgatcanactgacaatggcaatggcgaggacctc agctaactccaagttgtgcttaagacatggtanatgatttgctggtaata anaagtcttatgcatcttctgggcagctatanactaantctgttatgttt gtacttgaaccctgcatgcacgtacncatgccaatttatgtatgtctgtg taccactatgtttctgtctaaantatgctantgaaacattgtaatttgng gaannannnnn
Download
page-top