Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658451
Length 812 bp
Fasta Format > whhg15f22
ggtcgccgccagctcgagtccatggagccctgctccagcgtcaaggacag gattggatacagcatgatcaccgacgcggaggagaaggggttcatcgtcc cgggcaagagtgtgctgattgagccaaccagtggcaacacaggcattggg ctggccttcatggctgctgcgaagggttacagacttgtactcacaatgcc cgcctccatgagtatggagaggagaatcatcttgaaggctgctgcgaagg gttacagacttgtactcacaatgcccgcctccatgagtatggagaggaga atcatcttgaaggcttttggtgctgagctgatcctcaccgacccactctt gggaatgaaaggagctgtccaaaaggcagaagagctggcagcaaagacac ccaactcatacatccttcagcattctcaaactgctccgccgcggccgcca tggcgttcgagaagatcaaggtcgccaaccctatcgtcgagatggacgct tatcttcccatttttggacttggacattaagtactttgacttgggagttc tacaccgtgatgcaactgatgacaaggttacagtggaggctgcagaggct actctcaagtacaatgtggctattaaatgtgcaaccattactccagatga agatcgggttaaggagttcaacctaaaacaaatgtggaggagcccaaatg gcacaattaggaacattataaatggcaccgtgttcagagagccaattata tgcaagaaatgtccccaaaagcttgttcccaggatgggactaagcccatc tgcattggaagg
Download
page-top