Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ658450
Length 416 bp
Fasta Format > whhg15f21
gcacgagggaaggcgagccaaccaccaccgccgcgagactagcaccacga gcgagctcggccgattccgattccgtctgcgctattaaggtttgtttgga ggaaggggaggaggttcggaggtggagctgagagagagaccggagatggc ggcttccgcgaggcagggggagagggcgaccagcttcgccatggcctgca gcctgctcagccgctacgtccgccagaacggcgccgccgcggccgagctc ggcctcggaatcaacaagggtgaggccgaggctcacaggacggcggacac caagagccctttgcctggggcggagggcgaggaggccggcaggaagaagg agaccatggagctcttcccncagagcgccggcctgcangacgccnccnnc nctgacgctactaggg
Download
page-top