Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ657619
Length 370 bp
Fasta Format > whhg11j22
atcgccagcggcctcgcacgccgctgcattgtgcagatctcatacgccat cggtgtgcctgagcctttgtctgtgttcgtcgactcctacggcaccggca agatccccgacagggagatcctcaagctcgtgaaggagaactttgacttc aggcccgggatgatcagcatcaacctggacttgaagaaaggtggaaacag gttcatcaagaccgctgcttacggtcactttggccgtgatgatgccgact tcacctgggaggtggtgaagcccctcaagttcgacaaggcatctgcctaa gagcatggcattctcttggtctgccgcctctcaagttcgtcaagacggga tcatgttgctcctgggaagt
Download
page-top