Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ657281
Length 734 bp
Fasta Format > whhg10c09
cggcggcagttccactccctcgccatgggcaagattaagatcggaatcaa cggtttcggaaggatcgggaggctcgtcgccagggtagccctccagagcg acgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagtac atgacctacatgttcaagtacgacaccgttcacggccactggaagcacag tgacatcaagctcaaggacgacaagactctgctctttggcgagaagccag ttaccgtcttcggcgtcaggaaccctgaggagatcccgtggggtgaggct ggtgccgattacgttgtggagtccaccggtgtcttcactgacaaggacaa ggccgctgctcacttgaagggtggtgccaagaaggtggtcatctctgccc caagcaaagatgcccctatgtttgtggttggtgtcaacgaggacaagtac acctcagacgttaacattgtctcaaatgctagctgcaccactaactgcct tgctcccctagctaagatcattaatgacaacttcggtattattgagggtt tgatgaccactgttcatgccatcactgccacacagaagaccgttgatggt ccctcnagcaaggactggagaggtggcanggccgcaagctttaacatcat tcccancancactggtgctgctaangctgttggtaangttcttcctganc tgaatggcaancttaccggtatgtctttccgggt
Download
page-top