Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ294062
Length 483 bp
Fasta Format > rwhsl10m08
ccgtacgtttttattnttntattattatcttgcatgcatcgatcgagatg cagcagctggctagtggcgacacggatatacatacgacatacgtacgtat aagggggcacacacacacacacacacattcaagtaggtacacagacgtat ggctccatgggctagctagctgacgtacggcgagggccagctagccgtag cattccacatatgatcagcactgcctgatgcacttgcaccggcggagggg cccgtcgcagttgccgccgccccagcgttcctgcaggcagacctgcgcgc agttcttgtccgacacgcatggccccttgaaccccgcgcttgcgctgccg gcagatcttcgcctccgcccccggcaccgccgnctnctgtgcgatgagga ggagaagcaggaccaaaaccacctgcgtcgccaccttcttggtccacatg gtgagcggccgggctgggagcgagctaaactcc
Download
page-top