Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ294042
Length 507 bp
Fasta Format > rwhsl10k17
tattattatcttgcatgcatcgatcgagatgcagcagctggctagtggcg acacggatatacatacgacatacgtacgtataagggggcacacacacaca cacacacattcaagtaggtacacagacgtatggctccatgggctagctag ctgacgtacggcgagggccagctagccgtagcattccacatatgatcagc actgcctgatgcacttgcaccggcggaggggcccgtcgcagttgccgccg ccccagcgttcctgcaggcagacctgcgcgcagttcttgtccgacacgca tggccccttgaaccccgcgctgcgctgccggcagatcttcgcctccgccc ccggcaccgccgcctcctgtgcgatgaggaggagaagcaggaccaaaacc acctgcgtcgccaccttcttggtccacatggtgagcggccgggctgggag cgagctaaactctgcttgcgctacgtactggctttgttactaccggtgga gttgtgc
Download
page-top