Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ294029
Length 468 bp
Fasta Format > rwhsl10j11
ttttcgtcctttaagcttgatatactagtaaataaactgtaaagatcgtc ggcagaaccactgacgatgacaacgacgaccacgaccactactaccgttg aaacagcagcagagacacatgtaaccccgtactacatgtgtacgttattc aaaccttcaacagagagaagcaaaggtgcgagcttgcagcgcatgtcttg ccgccgcccgcgcgcgccctacggcgggcaacacatgccgcaacacgccc agccatatatggggcaagtgcggcagttgcagtttctgtagccgcaccac aggagccggcgtgccccgccgcccgccgccgctatctgcgtggccatcag caggaccacgaggagcatcacgcaggagacgaacatcttgttcctcagaa gtgctgccatgccgccgccggaggccatcgcttcagctgggtggtgagag tgagacgaagtgctcggc
Download
page-top