Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ294020
Length 613 bp
Fasta Format > rwhsl10i22
cttttattaccggaaaactcacgtactactacatgcatagaaaactcacg tgcatgcatgcattcatgcataaccgcgcacgaacacaagcatcgtctct cctctcctctcctctgctacacgcacgtactgtagtacgcagtaccgtgc tagctatttattcccgtcacactcacatgtacactcatgcatgcatgcag ctccagggaccgcatgcgcgcgctggagatcgtcgctcacatgtcggcga cgcggcgctgctgctgcgggccggggacgaacacggactccggctgcgcg cggatgaccctgtccgccagctccctcgcctgctgggggaacgccagcgc cttggccgcctcgtccagctgcttcagcacgctgttcccgccggtcacga acacctcctcgtcgttgttggcgcccacgccgaaggacagcagggcgagg ttcccctcgttcccggccacgaacgtcgccgggtggcccgcggggagcac gatcaccgaccccaccttgatctgggccctcacctgcctgtagcccctcg atttctcctgctcgccgccgtggccgtgctcctcctcctcgctcctcctg ccgtgctcctgcc
Download
page-top