Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ660469
Length 749 bp
Fasta Format > whhg4h16
ttctcccgtcccgtcccgtccccagccaacctcccatctccgtctcgcgt cgcggcggcagttccactccctcgccatgggcaagattaagatcggaatc aacggtttcggaaggatcgggaggctcgtcgccagggtagccctccagag cgacgatgtcgagctcgtcgccgtcaacgaccccttcatcaccaccgagt acatgacctacatgttcaagtacgacaccgttcacggccactggaagcac agtgacatcaagctcaaggacgacaagactctgctctttggcgagaagcc agttaccgtcttcggcgtcaggaaccctgaggagatcccgtggggtgagg ctggtgccgattacgttgtggagtccaccggtgtcttcactgacaaggac aaggccgctgctcacttgaagggtggtgccaagaaggtggtcatctctgc cccaagcaaagatgcccctatgtttgtggttggtgtcaacgaggacaagt acacctcanacgttaacattgtctcaaatgctagctgcaccactaactgc cttgctcccctagctaagatcattaatgacaacttcggtattattgaggg tttgatgaccactgttcatgccatcactgccacacanaagaccgttgatg gtccctcnagcaaggactgganaggtggcagggccgcaagctttaacatc attcccancancactggtgctgctaangctgttggtaaggttcttcctg
Download
page-top