Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293971
Length 522 bp
Fasta Format > rwhsl10e19
cgtttttattnttnntattattatcttgcatgcatcgatcgagatgcagc agctggctagtggcgacacggatatacatacgacatacgtacgtataagg gggcacacacacacacacacacattcaagtaggtacacagacgtatggct ccatgggctagctagctgacgtacggcgagggccagctagccgtagcatt ccacatatgatcagcactgcctgatgcacttgcaccggcggaggggcccg tcgcagttgccgccgccccagcgttcctgcaggcagacctgcgcgcagtt cttgtccgacacgcatggccccttgaaccccgcgctgcgctgccggcaga tcttcgcctccgcccccggcaccgccgnctcctgtgcgatgaggaggaga agcaggaccaaaaccacctgcgtcgccaccttcttggtccacatggtgag cggccgggctgggagcgagctaaactctgcttgcgctacgtactggcttt gttactaccggtggagttgtgc
Download
page-top