Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ660193
Length 719 bp
Fasta Format > whhg3c20
ccgccgcctaccccaccaacctgccccgacccgctcccgacctccgaggc aatcagcgtccgccgcggccgccatggcgttcgagaagatcaaggtcgcc aaccctatcgtcgagatggacggcgatgagatgaccagagtattctggca gtctatcaaggacaagcttatcttcccatttttggacttggacattaagt actttgacttgggagttctacaccgtgatgcaacgngatgacaaggttac agtggaggctgcagaggctactctcaagtacaatgtggctattaaatgtg caaccattactccagatgaagatcgggttaaggagttcaacctaaaacaa atgtggaggagcccaaatggcacaattaggaacattataaatggcaccgt gttcagagagccaattatatgcaagaatgtcccaaagcttgttccaggat ggactaagcccatctgcattggaaggcatgctttcggtgatcagtacaga gcaactgatgccgttctcaagggacctggcaaactcagactagttttcga gggaaaagacgagacggttgaccttgaggtttttaacttcactggtgctg gaggagtcgccatggctatgtacaacacagatgagtcaattcgaggtttt gctgaagcttctatggcaatcgcttatgagaagaaatggccattgtacct tagcacaaaaaaacacaat
Download
page-top