Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293949
Length 712 bp
Fasta Format > rwhsl10c03
atttatcntcatacgacaaaaggttcacaccacaattcatgcacccttgc ttgcaccagaacacgcacataacacccacacacacaagccaggcaaggga cagtccacgcagagtgcacgcttgcgacaaccagagcacatcaaggctcg aattattccaacctagacagggcctactgctgcccatcactaccgacaca atgggggtgggtcgggtctccaagcggcgggagggcttacgggttcactt tcggcgcccacccggcgatcaggttctccttggtcgccttggtcttgacg aacgactcgcggctgaagagagcctcggtgtaggcatggacgctggtcag ggtttcagggaccttccagcccttgaagtgctccagggcgacctggaggt ggtagagcttcggagccaggctgagatcgacggcggagatgttcgccccg ttgatgtagggtccatgggccttcaggtgctcttcgagtgcctgcagctc gtcaacaagtgccttctccgaaccatcgctggcatccttgctcttcaaga acgtgacgaaggtggagaagatctttgatcccactgatgcatactcagga ggggtcacaagtgatggagttgggtacttctcctcaatgacttgagtgat cacatcagaatcagcaatccatttgccatcaccaccgttatacacaggca ccttgccctncg
Download
page-top