Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ660014
Length 769 bp
Fasta Format > whhg2g01
cgcccctcgctgccgctgcgtctcgtctccaccaccccacttgcccccgg actcaggaggatcgtcggagatgtcggacaccgatgagcaccacttcgag tccaaggccgactccggcgcctccaagacctacccgcagcaggctggcgc catccgcaagggtggacacatcgtcatcaaggcccgtccctgcaaggttg ttgaggtctccacctccaagactgggaagcatggtcacgcaaagtgtcac tttgttgccattgacatctttaatggaaagaagcttgaggatatcgttcc ttcatcccacaactgtgacgtcccccatgttgaccgccaagattatcagc tgattgacataactgatgatggatatgtcagccttctcactgagagtggt aacactaaggatgacctgaagcttcccactgatgatgttctgcttggcca gatcaagactggatttgctgatggcaaggacctgatcctgtctgtgatgt ccgccatgggtgaagaacagatctgcgctgtgaaggaaatcggtggtggc aagtaagcagctgtgcgtggttgcctacctgcgatacttggtatctagtg cttctgggtgtttgagatacacatacataggcatcaagatatctgttggg tgaaacaagtttgatccagatttgtgtgttttttacaccgaatgctcgag gtgctgctagtactttgttatctatctatctatctctattataataccct ttggaattgaaaaaaaaaa
Download
page-top