Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ547955
Length 802 bp
Fasta Format > rwhgc3h11
ggatgttctggaggtactgcagtagcaaacacaaacaaagcacctagaga tctaacctactcatgtccattagaccattacatataaggcgcaagtactt agatatgcaacttaacctagccgttaagttgctctccttgcgactgtcta gaggaccagcaagccactctgcaaaaacaactcttccaagagtgcttata ttatttcgatagctccaggggagcctaactcttgcatgcgtggacacagc catatcaaccattcagtgtagacttgtaatggttgtcatcaatagttgga tagaggttgccaagatcaataagatgtgcaacagtcgacctggcaagtgc atctgatatgttaagacggcttgcaacctgtgcgatactaactccatgct ccaggtttacaagcactgggtcatgaaaaacattcatgaccatatcagtt aactcttgcccaccagcattcccagatgcagatagtgttggggcctgatt attagggggtggagcttggttccatgttgatgcattagcagttacttggg gctgcgtcgcagatttcttagccttggcaagatccaaatgcacataaatg cagtacagaaagtgatgtgttatatcattgtagttggttacaagccgcac ggaataagcaacaatgtgacgcttcccttgaaacctttcagaccaccatt gacaataacatagtcaccatccttgactaacccatttctgtattgtccga tgtctcatttgcccngcgattcacttctatccngcnngtaccatcatcaa ga
Download
page-top