Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ547503
Length 750 bp
Fasta Format > rwhgc20k01
cacgaacaaaataagataactgaacgctggctaggaatgtcgacagaagt actcaagaaatcagccatcaaaactgactacaaagttcacgacacccagg tggcacatatatcatcttctagatatgaagcagcaaaatagcgacttcta ttttctactcagcagcagcaacctcctccgctccaggaatcacctcatct ccatcagcaggcctgtcaagcttcacaccaacatcctccttgtagtcacc gtgcacctccatgagcttccccaggtcaaacttgggggccttcaggatct tcaccttgcggacgtacacgttctggagggggaagatgcttgaggtggcc ttctcaatctcctttccaatcacctcagggatgaacttgttcacaagctc cttcaagtcacagcttgcagcttggttgaccatgatctcaaccatcttgc ggcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttcacc tggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatgta gttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgccact tcctcacaagagacctgagcttgtcagtggtgaagtccatgccccagaag tttgtgaggacattcatcccttgcacatcctcagcacggagtctgatctt cctgtaggcctggtcctcatcgttctgaagatcagctagagatacttcga
Download
page-top