Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ546847
Length 708 bp
Fasta Format > rwhgc18n24
cctttcgggggttccttagggaccgattcactctgcgtagattgactgaa cgcagaaagccttccactggcaggcgatcgtgtttttcacaggatttctc gttactcatgtcagcattctcacttctgatatctccaggtcttgtcacca aaaaccttccccgattgacagaacgtcccgctactgacacttgaaaaagc tgctttcaaggtctcgtcgcttcggtgaatcacttgagccctgagacatt ttcggtgccatggagctagaccagtgagctattacgctttcttcaaagga tggctgcttccaagcccacctcctggttgtcatcgctcgatcacttcctt ttccactaagtgattgcttagggaccttagcgtacgatctgggctgtttc cctctcgactttggatcttagcacccaatcagtctgtctgtactaaggat gacggcctgtattcggagtttccctggggttggtaaagcgaaatgggggc caccctagcccattgagtgctctacctcgggccatcgacatcatacgctc tactgaaatagatttcgcggaaaaccagctatatccgatcttggttggcc tttcacccctagccacaagtcatccccgtattttgccacatacgtgggtt cggtcctccaaggcctgttagagctctcttcaacctgctcatggctagat cgatcggt
Download
page-top