Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208641
Length 586 bp
Fasta Format > wh10b15
attcggcacgaggcttcttcnaccctagcccccttgcttcctccccccct ccccttcccgcttccgcttccgcttccaagcaccctcaccacccgcggtc cacgcccatcggatcccgagccaccatcccgcaagaatacctcttcgcgc ccagtagcttcgttgtctgagggggagtcatggaggacggcagcggcggc gccggcggtgaggggagcacgagcggggggaggttcccgatactgcaggc gaaccgggacccggagtcgaactgggaggtggacgtcgccaagagcctcg aggagtacctcctcaagatctgctcaggcgagatctccgccgaagacggg gcccacagcttcaacttcgccgaagctgcgctattgctccaaggttcagt tcaagtttacagccgcaaggtggagtacctgtactcattggtgctacatg cgctggaatttctctcgcaaaataagcaagatcaacaagaaaagggatct gctgaagctaacgaaaatggtcctagcactactgtcaacaaagaagatga tatgtttatgggtttagatgatgtcccagcggaaac
Download
page-top