Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ546764
Length 738 bp
Fasta Format > rwhgc18i23
cgggggttccttagggaccgattcactctgcgtagattgactgaacgcag aaagccttccactggcaggcgatcgtgtttttcacaggatttctcgttac tcatgtcagcattctcacttctgatatctccaggtcttgtcaccaaaaac cttccccgattgacagaacgtcccgctactgacacttgaaaaagctgctt tcaaggtctcgtcgcttcggtgaatcacttgagccctgagacattttcgg tgccatggagctagaccagtgagctattacgctttcttcaaaggatggct gcttccaagcccacctcctggttgtcatcgctcgatcacttccttttcca ctaagtgattgcttagggaccttagcgtacgatctgggctgtttccctct cgactttggatcttagcacccaatcagtctgtctgtactaaggatgacgg cctgtattcggagtttccctggggttggtaaagcgaaatgggggccaccc tagcccattgagtgctctacctcgggccatcgacatcatacgctctactg aaatagatttcgcggaaaaccagctatatccgatcttggttggcctttca cccctagccacaagtcatccccgtattttgccacatacgtgggttcggtc ctccaaggcctgttagagctctcttcaacctgctcatggctagatcgatc gggtttcgggtcaaataggaagaacgtaaatcttccac
Download
page-top