Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ546624
Length 609 bp
Fasta Format > rwhgc17p08
cgcggcgcagcagttcttccataccaacttagctgcccggcgctgctatt ggcataacaaccggtacaccataggttgacccagcccagtcctctcgtac tagggctggctcctcgcagttctccctttaacaccaacggtagataggaa ccgaactgtctcacgacgttctaaacccaactcacgtaccactttcatcg gcgaacaaccgaacccttgggaccttcttcaaccccaggatgtgatgagt cgacatcgaggtgccaaacgactccgtcgataagagctcttgggagtcat cagcctgttatccccggcgtacctttgatccgttgagcgagagcccttcc acacgggactcccggatcactatggccgactttcgtctctgttcgaccag tcggtctcacagtcaggcaggcttataccattacgctcacgagcagaatc aacgcttgagcctaccttcgcacacctccgttactctttaggaggcatcc gccccagataaactacccacctcgcagtgtcccgccccccccgaatgatc ggtgcggcggttaggcatccttagacgaaagagtggtctttcaggattgg tcgttgtgt
Download
page-top