Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ545961
Length 716 bp
Fasta Format > rwhgc15b23
acacaacagggttgctaaaccaaacaccacacagcaaacattcaattcaa acagacagaaaacagataaagccactcgggcagatcatcaggtcgcaatc tcagctgctctagtactcatcaccctcatcaccatcctcaccctcgtcga actcagcaccaacttcttcatagtccttctccagggcagcgagatcctca cgggcctcagagaactctccctcctccatgccctcacccacgtaccagtg gacgaaggcacgcttggcgtacatcaggtcgaacttgtggtcgatgcggg agaagacctcgacaacgctggtggagttggagatcatgcagacggccctc tggaccttggcaaggtcgccgcctgggacaacgctgggtggctggtagtt gataccacacttgaaaccagtggggcaccagtccacaaactggatggtgc gcttcgtcttgatggtggccacagcggcgttgacatccttgggcacaaca tcaccacggtacatgaggcagcaggccatgtacttgccgtggcgggggtc acacttggccatcatggaggaaggctcgaaggcgctgttggtgatctcgg caacagagagctgctcatggtaagccttctcggctgagatcactggggcg taggaggaaagcatgaagtggattcttgggtagggcaccaggttggtctg gaactcgttgacatca
Download
page-top