Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ545386
Length 422 bp
Fasta Format > rwhgc12o17
atgaagatatatttgtgtaccaactccagtaaaggtaaacaaaaaaacaa gagctaacatccccaaccaattatatttccagaccggtacaatcttaggt atacttgtcatatgtatgatactaccatgtttttgctgtgcaatgtctaa acggcccggaatatttctaccaggtgtcgccgcttcagaagatccaaaag actgttctcagtgatgtcttcgcaaaatcagtcgcgggcaagttcttgag gaggagcccggtagcctgcgacaaacaagccgtctcaaaactgtagcagc ttcgcctccgtttcgctgctgggtggctacttgtcttgatgaactattca ttgtcggagacctctgcacttcctcccacccacttccatacgcccccaga tttccgtctctgagaagtcgtc
Download
page-top