Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ545373
Length 654 bp
Fasta Format > rwhgc12n17
gtcacacatgctatctatgagcagtcacacacaccctgggcccgctactg ggccaataatttatcgatgccgtgtgacgatggtggatgggtggattaag aattaacttactgcgcgcagacgttgcagctcttcctgcagaagccagga gcttccttggtgcccaccatatagttggggttcttggcgcactccccaac ggcagcccactgcgagcagaggacattctcgtcctcgcacccacctccct gcttgcccgagttttcgaaggacctcacatggatccatttcgtggcggac cacttctggccttcgatgacggggcagctcccgtgcaaactgtcagggtc tgtcgttgcatcagggtggaggctgaagaacagcagggcgttacctttta cgggctttactgcatatccatttttagcacactcagatgccgtctcatcc ttgtgttgtgttaacttcccctctgcgttagggaagatggtctctccacc cttctcaatgttagacagatacatgagcactgttgctattcggtgaccac cgagagcttggttatttttgtcatggaagtaatcatagtgtggctcatac ttctcaccattcttatagtgtaatatttgaatggactcgccattctccga cgga
Download
page-top