Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ545359
Length 402 bp
Fasta Format > rwhgc12m19
ttttaataaacagtcgctaccccctggtatgtgccgctttcctaatcaga agataggagagcaccccttctcccgaagttanggggtcattttgccgagt tccttcgacatggttctctcgacgcgccctantatactctacttgttcac ctgtgtcggtttggggtacggtcagttcaccgggaggatcnccctcccaa ttcgaagttttttcctggaagtttcaaccgtcgttgactatgacnacagt cgcgaccgactattaagatcctcgcgactatngcagggcggtacgctctg ctctctcgcgacctccactctnatcaaaagactaaaggcccctacggaag atnaaaaangcnaggactgaaatgagaaaggaaggagttcggcggcacga gg
Download
page-top