Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ545280
Length 340 bp
Fasta Format > rwhgc12h24
tgggcntagctggttccagtggtctaccgtatccgtgtcaggcgtggtgg caggaagaggccagtgcccaagggtattgtctatggtaagcccaagcacc agggtattacccagctcaagttccagaggaacaagaggtctgttgctgaa gaaagagctgggcgcaggctgggtggtcttcgtgtgctcaactcctactg ggtgaatgaggactctacctacnagtactttgaggtcatccttgttgatg ttgctcacantgctgtccncaacnacccaaggatcaactggctctgcaan cccgtgcacaancaccgtgagcttcncggactcacntcng
Download
page-top