Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ290072
Length 608 bp
Fasta Format > whsl8k22
ggctacttcgagnatggcgtgcccgcacgtctccagctccggccgttctg aacgccgggagcacgagcaggagcgcgagcgcgaacacggacacggcagg agaagcgaggagcgcgggcaggagcacggcaggaggagcgaggaggagga gcacggccacggcggcgagcaggagaaatcgaggggctacaggcaggtga gggcccagatcaaggtggggtcggtgatcgtgctccccgcgggccacccg gcgacgttcgtggccgggaacgaggggaacctcgccctgctgtccttcgg cgtgggcgccaacaacgacgaggaggtgttcgtgaccggcgggaacagcg tgctgaagcagctggacgaggcggccaaggcgctggcgttcccccagcag gcgagggagctggcggacagggtcatccgcgcgcagccggagtccgtgtt cgtccccggcccgcagcagcagcgccgcgtcgccgacatgtgagcgacga tctccagcgcgcgcatgcggtccctggagctgcatgcatgcatgagtgta catgtgagtgtgacgggaataaatagctagcacggtactgcgtactacaa aaaaaaaa
Download
page-top