Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ549370
Length 318 bp
Fasta Format > rwhgc9g01
gtctcatttcatacgaagcaaataacactcagtagtaatactacgaatca actcgatctaaggtccaaaaacctcacagggcagatatgttatgcttgct ttagctacgacaccatcacggcaacagaaaactgtagatatattgtgcgc ccaccgccatcacctgcctcaggaagatttagattttgttgaaggcaaca atgtcacagctctggatgtactcgttggctggttcaacgcagagatggtc ttcaataagagtgtcgacagagacgaggtcatcaatgatggtcatcataa tctggagcttcttgatgc
Download
page-top