Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ549021
Length 702 bp
Fasta Format > rwhgc7n22
cattcgccactcagtttacaatacacaccgacaaccgcctcaaaaaccac caaatcaaagggatgagcacatggcgccgcgccgcgccgagaaacaaact agcctaaccaacaggtggatacagagacccagattattcaaagtaaacac ggctatggtggcgacatcctccttgcaattaaaatgggggagctgctata cggcttactgcgccttggcgagctcggcgcggatctgcttggcggcctcg accatgttggtgagggcgggcttgacctcggcatacttgcgggtcttgag accgcagtcggggttcacccacaggatgttggtgtcgagcaccgcgagca tcttgttgacacggtcggcgatctcctccttggacgggatcctgggggag tggatgtcgtacacgcccgggccaatgccggcgccgtacaccacgccctc gcagaagacggagagaagcttctcgtcggaccgcgagttctcgatggtga tcacatcggcgtccatgttgatgatggactggatgatgtcgttgaagttg gagtagcacatgtgggtgtggatctgggtggtgtcctggacaccgcantt ggtgatcctgaangantgcacggcccantccaantanaaancatgctccn acttgcggantggcanaccctctctcaaancancctcatcnatttggata ac
Download
page-top