Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ548829
Length 753 bp
Fasta Format > rwhgc7c05
tntgttccaaanctcgtacgagaacttgtatagagaaggatttcccgcgg cgcagcagttcttccataccaacttanctgcccggcgctgctattggcat aacaaccggtacaccataggttgacccagcccagtcctctcgtactaggg ctggctcctcgcagttctccctttaacaccaacggtagataggaaccgaa ctgtctcacgacgttctaaacccaactcacgtaccactttcntcggcgaa caaccgaacccttgggaccttcttcaaccccaggatgtgatgagtcgaca tcgaggtgccaaacgactccgtcgataagagctcttgggagtcatcagcc tgttatccccggcgtacctttgatccgttgagcgagagcccttccacacg ggactcccggatcactatggccgactttcgtctctgttcgaccagtcggt ctcacagtcaggcaggcttataccattacgctcacgagcagaatcaacgc ttgagcctaccttcgcacacctccgttactctttaggaggcatccgcccc agataaactacccacctcgcagtgtcccgccccccccgaatgatcggtgc ggcggttaggcatccttagacgaaagagtggtctttcaggattggtcgtt gtgtgtcaccacctcccacctatcctacacattcgatcaaggttgtcact gcgaagctatagtcaaggtgcacggggtcttaccgtctagccgttggtac tcc
Download
page-top