Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ548727
Length 608 bp
Fasta Format > rwhgc6l05
attttctacaatttgattactcataaattacatgtatacagtattaccta tgagtagttatggatatatcacacttatggctttctatctagatatatgt agaccctgctcaatgaagctagcaagctgataagcatatccaacactcct tattctcctaacactgaagcttaactttgcatcgttgctgagtaacatat ctgtcaggattcagaagaatcaagcttttgacagaggaatgaatccgtgc ctaatagccgccgaccaaaccttttcgatgtccatcatatcatctccgca ctcatgcatgttccaaccttcctgagcatgtattatcccagcaatgcgcc atgcgctcatcacccttcttggaagccaattctcacaggcatggacgttc tgcatcgtctccgggattttcattgctggggtactcaggtaagtgcaatc cttgcgtgtcttcttaaggggaaactgtgatgtaggaataaatattgttc cacttggtgccctcctttgttgtttatcatctatgatatctcctatccng atctggggtatttcatcactggagaatttcagataggcagtgctgctctc tggaaccc
Download
page-top