Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ548717
Length 557 bp
Fasta Format > rwhgc6k12
cttagcttcgtcccgaatccgacaggtccatgcacataaaattaggcggg ggatatacatgggcctggtgaagcactcgcaacaacgaaactcccctccg acaaatctaattttcaaaagttatgtaacaagaaaaagagcgagagaaag gaagaaatggctgccactcggctcctatggtgtgcacaggttcttcaggt cttcctccttggcgtacgagttcgggatgagcctcgcggcgtaggggtac aggtccttgtacgaattcctgatggtgccttctgccactccggtggccaa ggagatatctttaagcggctttttgtcctctgaaagctgggttatcatat aaatgacagcagccgctattgaaataggactcctccttatatcaagctcc tctgagcgctgaactgcctcctgagctgctttaacagcagtattgttcat cccaagagttgaacagaaacgcctcaggaaatctccagcatggatggttc ccatctccatagattggcccatttcaacttccagttgtttcactatgaac tcttttg
Download
page-top