Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ548534
Length 411 bp
Fasta Format > rwhgc5n17
ggcacaagacagacaccaccaagggcacgatatgcagcgctancagctga acngctnagatatacccaggtacgaacaatgcccttaacaaaactcagcc gatactaaaaactgcttggtgtctgaaacacgtgatttggatatcaattg tggaattacttcttcttgatggcagccttggtcaccttggccccggttgg gtccttcttctcaacgcccttgatgacaccaacagccacagtctgcctca tgtcncggacagcaaaacnaccaanaggagggtaagtggcaaaggtctcc acaaccatgggcttggtgggaatcatcttcactatgccancatcancatt cttgaggaacttgggcagggcctccnnctccttaccataccgcctgtcna tcttggtcacc
Download
page-top