Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ547819
Length 711 bp
Fasta Format > rwhgc2o14
ccacatcaatacaaggaaatactcccaggacaacagagaccacaaactag ggtaggtaatagacataagctgtggcataggttcataatattgccaatga attatttaggagatatatatcatcatcatcatgactgaaaacaggttccg accaattaagccgcaatcaagcaaagatagtagcttaaagagttgcacca gctcctgctcctccacggcggcactcgttcagcatgtcgaggtagaactg gcacttgctgatgtcgcttccgtagtggttgatgcaatcttggaaggcct tggaagggttgccacacttgtcatcagcagcattgtccattggagtcata gatgcagcagcctcaccgacaacagtctcatgctgaatggtgcggggacc catcacagcatcaacagccctgtgcgccatggcactgccagtaccgaaag ccatgccctgagcaatggtggacccaattccactcatgataccaccaccg ctattctgggtagtagcaggtggaggagcttgacgggctggcgctggtgg gtttctcactggagcagcacgtggagcagggcgggaagaccttcctcctc cgctgcggcgagccatggcggcggacggcgggaggaaaccctaggctgga ggcggcgccnggaggggagaatgtatgaacaggaagccaacggatcggaa tcggcacgagg
Download
page-top