Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ547776
Length 520 bp
Fasta Format > rwhgc2l15
gatacttaggtctcaaacatattaaatccgcaaaattcgacctaaaagca cataagataagtaatccttagcataaaagattccacaggagaactggaat tgaactgcttagtcgaacaagctgaagcccatgtcatcatcgctctcttc cttagcctcctcctttttctcttctttcttctcttcagcggcagcagcac caccagcagccggggcagcagcagcagcagctggagcaccacctccacca gatccgacggaaaggatgaggtcatcgacgctcctcttctccaggagctt ggcgaagagcgcgggccagtaggcctcaaccttgattccggcagccttca ccaccgtcgcgatcttctcagaagtgatggggatcccgtcatcgtggagg atgagggcggcaagggtgcaggcgacctcgctggaagacatggcgacgga ttctcaccggagcagatctgcgatcttgggaggcgatggaagtggaggcg caggaggcagcggcacgagg
Download
page-top