Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544823
Length 769 bp
Fasta Format > rwhgc10g12
tctaattacatggtatacaggtattacctatgagtagttatggatatatc acacttatggctttctatctagatatatgtagaccctgctcaatgaagct agcaagctgataagcatatccaacactccttattctcctaacactgaagc ttaactttgcatcgttgctgagtaacatatctgtcaggattcagaagaat caagcttttgacagaggaatgaatccgtgcctaatagccgccgaccaaac cttttcgatgtccatcatatcatctccgcactcatgcatgttccaacctt cctgagcatgtattatcccagcaatgcgccatgcgctcatcacccttctt ggaagccaattctcacaggcatggacgttctgcatcgtctccgggatttt cattgctggggtactcaggtaagtgcaatccttgcgtgtcttcttaaggg gaaactgtgatgtaggaataaatattgttccacttggtgccctcctttgt tgtttatcatctatgatatctcctatccagatctggggtatttcatcact ggagaatttcagataggcagtgctgctctctggaacccgcaatttaagca tgtcatattcattcttttggttcatgattacctggacacctctcttacat aaagctgtagctgtggcatgggctaccttagaactgcttccaaacagaaa aacttgctttgtatatnaangggatgctcttgagcaccactgcagttgct aagccacttccatcaacaa
Download
page-top