Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544819
Length 529 bp
Fasta Format > rwhgc10g02
agcagtgccgtaaagaaacgagcttacagattcagatcatctgctaacag caaatggagtaacacgaaacaacaagagtcaagtgaagtgacagctttgg cttcacaaaatgctaaattcaaaataggtccaataagtaggccctgggag ggtatgtgagctcatccggaggctttcttttgctggaagatgaccgcgaa gaccgggacaccgacaccaatgcttacggctcccagcactgaagtccatg cagtcagcttctgatgcttcatcctgtgcaagttgtacatgtgcttggcg tggaggtagtatggctcatcatggccgtgccctgacatcctcttcacgcc ggtagcatggaatccacgtgaagctggcttggaggcctcggcgccggtgg cgaggaggcggatcccggagcggaggccgcggttgagagcagtcgccatc gccttcgtgctcgtgttcgtctggtcgccgccgccggagttgtggtggtg ggtgcgttttgggggtgatttaaccgatc
Download
page-top