Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544813
Length 765 bp
Fasta Format > rwhgc10f19
actctggagaaagagcattatgaggagagcattatgaggggaaactacac aaaacagaatatgaaaagtgaaagtgacgaagtgacagagcaaattgcac atcactcagcagtttcagcagactcaaaaagaaaaggaaaaatatatgaa atgatacaccagtaagaaaacttagcactgatcactagacggcacgacca gtgtagcacgtcgcggtgatgtcgaatgcttcttcttacttcccaggagc aaaaggatcccgcctttgtcgaacttgagaggcagcagaccaagaataac cccaatgtgatgtcttgttcttaggcagatgccttgtcgaacttgagggg cttcaccacctcccaggtgaagtcggcatcatcgcggccaaagtgaccgt aagcagcggtcttgatgaacctgtttccacctttcttcaagtccaggttg atgctgatcatcccgggcctgaagtcaaagttctccttcacgagcttgag gatctccctgtcggggatcttgccggtgccgtaggagtcgacgaacacag acnaaggctcaggcacaccgatggcgtatgagatctgcacaatgcagcgg cgtgcgaggccgctggcgatgatgctcttggcggcctgcctggcaatgta ggcgccactacggtcgaccttggttgggtccttgccagagaaggcaccgc cgccgtgggctccccagccaccataggtgtcgatgatgatcttgcggccg gtganacggcgtcnc
Download
page-top