Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544808
Length 720 bp
Fasta Format > rwhgc10f12
atgaatggcatacactataaatagcagccagaaaaagaggtaaagcctga ttttgaagcagaagtagtgcttcggaagaccagtacttaacgcctggcaa gaggcgtttaattatgcataactccagagtcaccgtccatcacaaccatc agtcaatggggcaaaactaaatggcagctggaataacagaggtaaagatg cctgccctggaagcaaaagatatgcttcaggacaagcacaaatcacaaga aatccgcttcttgctagccacgaagacagcttcagtacagcaccttgtcc acatcatcgaagtatgggtgctccatggccttcttcgcagagatccgctt tgccggctcatactgcagcattttctcaagcagatcaataccatcggcat cgagactaggaatgacagaagacagctttgagacattccactgagggtac tcatgccagttcgggagtttgcctactcctggccagacatcctcatttgg agtgcccagcaacttgaaaatgtgcaggagctgctgcacctcagagtctc cagggaaaagtgccgtggtagtgatcaattcagcaaatatgcagcccaca gaccacatgtcaaccggcgttgagtagtgtgtggcgcccagaaggacctc cggagctctgtaccacagagtaaggatctcgtgtgtgtacttcttgagag gaaccgtgaaggcacgactg
Download
page-top