Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544805
Length 769 bp
Fasta Format > rwhgc10f07
agcattccatatatcttacacgccatcacagatcgtccagttataatact gctcaagttttagactcaaagggtaacatagcatgccagcaacatcacac atatcctacaatgcaatcacatatcatccagttatactactactaagttc taggtggcagatcatagatggatatatatttcaagagacatacataacat agtgctgtaatggaactgatatcgtcttgcttctccatcaaacaagagat acatttcgtctccattcaacttgctttagcaacaggctgatatccatctt gcttgttcactccctcagcagtagcaacaggctgatatccatcttgcttg tccactccctcagcactagcaacaggctgatatccatcttgcttgttcac tccctcagctgtagcaacaggctgatatccatcttgcttgtccactccct cggcagtaccaacaggctgatatccatcttgcttgttcactccctcagca gtagcaactctccgcagtctctcttgtattacttgcctctccagcctctc ttgtatcangggcacactctcagcagtaacaagatagtcaccatacctta cgatttcaggacgggaaatcaaggcataataagtgagcccagaaataaca agaatacccgccgacctagtgaagtcggtcaccttcttggttctacatat cttgcgccattgagggtcctctggtctaggcttgacttgtgtagagagat ccttgagcagactttggtt
Download
page-top