Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544803
Length 705 bp
Fasta Format > rwhgc10f05
ggaggtgatatcatgtccagtccagtaacaaggttacacaccatctaaac caccataaccctgaagaaattagccgcttcacaagatgactgaatgaaat gtatagtaatgtacagtgctagtgacttcacccaccaaaagaaatcccaa aaaaatacaactctggtgtcttttccctgcagaatctaatggtctgatgg tacttgcatgacactgggaggcgaacggcgaatttcacctgctccaagct tctgataaaaagatgtaccggaaggctttgcttggagtttaaagtagtgg attgcagagatattgtgcagagccagaaaagctggaggcaggtgcatcac cgagaaggaaaatgcccacgatcaagaatgcccaaattgggacaatactg attgaaacaaggtagaaaatgcctcagcagtagtcccatcctcggccttg attttgagctgggccttcgctgatgctgtgttaacaatgcattctacaag gtagaaagcagcagccccagctttctgaccataaaagtagaacttgtagt ttggaggctgaccgcctgaagcaatgcattgaatgtagttgctttgcata tgacgaatgagcgattggggattcatcaaagaagctgctccttgtggact taaagagcattcctgagaaaaggataatgccagttggccccatttcttct ggaaa
Download
page-top