Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544800
Length 416 bp
Fasta Format > rwhgc10e23
ttgttctagacagaccctgattgaaatacattgcaaaatatttctgcaac aggtgtggggtatcatctactccctccatcccataatacaatataagagc gttcaggagtacaactccccttaaagaaaaagtaccacgagttcatcatc agaacgaacaattaatcaatcgacagatgatgagctgaccgtcctagcta gctaggcttcgatggatgatttggtgaggtcgaccctgctgatgtacgag cttgccagcgacccgtagtagaggtagcccccgaccttgagccagccggt ggcgagcgcgagtcccgggtcagtgtacatggtcgccggctcgccgttta gagccacgctcatcgtccccgagtccctcaggccctgcggcaccgccatc acgtacttccccacca
Download
page-top