Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544798
Length 556 bp
Fasta Format > rwhgc10e18
ctggtgagattacatacaagtctgggtccaggttcaggtgaatacagagc aagactagtacatcaaacttggaagacaaattggaattccacggtagtaa cacggatgatgatgggaagagatagccgccccatcagaaattcagaacac gcagcctgctcttcggtttgggctggcatcttctttgcagcagcaggagc ggcttaggacttggtcttgaacgggatcgctctgatgaccacctggtggt acacggcggccagcgcggcgccgatgaaggggccgacccagaagatccag tggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggct cctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgga ccaggaacacggcgaacccgatgggcagcggggcgaggatgggaacgtgg gagtccctggcgttcctcttggcgtcggtggcgganaagacggtgtanac naggacaaaggtgccgatgatctcggcgccgaggccggagcccttggtgt anccgg
Download
page-top