Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544797
Length 681 bp
Fasta Format > rwhgc10e17
tggcgacgttggatcgatcatatggtcgccaaatttaaatacagtaggaa aagcaatgcgggctaattaagacaaagcgatcccatggaccgaattacaa gacacggcacgcaggaccgggcacatggaggccaaccacgtactcgcact acgcatatgctgctgccgacacataaataacacgaccattgcgggccaac tgaactgttgagaagttgcaaaagcgcatttctctctggatgggcacaac acaggtcgccattgcttcaatcttgcatggagctgacgtggatgataact tgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccct gaggatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggc cgacccagaagatccactgatcatcccaggccttgtccttgttgtagatg acggcggcgcccaggctcctggccgggttgatgccggtgccggtgatggg gatggtggccaggtggaccatgaacacggcgaagccgatggggaggggcg ccagcaccgggacgtgagagtcgcgcgcgctgcgcttggggtcggtggcg gagaagacggtgtanacgagcacgaaggtgccgatgatctccgcggcgac catcgtggacattgaagtgggacttggccca
Download
page-top