Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544787
Length 473 bp
Fasta Format > rwhgc10d24
attggtcgtacatagatatattttgggctgcctagctagactgctagagc tagctagtcggtgaagttgcaacacacgcacgcaagttcaactactagca ggagcaataatagatattttgggctaagctaaggtagctagtctgtgaag ttgctgaggcatgcgtgtggctcggtggccttggcggcgggcgtgggctc gacggtgggggagggcgggacgggcgccgcgcagagcagctcctttggca ggtcggggatgcccttgaggtagaaggtgtagaagatcttgaaggggaag acgatctggttgagcttgacctggccgtaggcgccctcgaagacgccgga gccgccggtgacggcgaggtaggactcctcgtaggtgaggtagggcccct gcacggcgatgtggccgtagtcgccgaagtagatgctgtagatggcctcg tagcggtcgccgttgcgctccgg
Download
page-top